View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_84 (Length: 265)
Name: NF19192_low_84
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_84 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 28833635 - 28833403
Alignment:
| Q |
1 |
ctatagctgatatactatcgcagatactatcacagagatatacacaattagccgagctacataaacaaatggtcgtgttatattgtttgtgatttgcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28833635 |
ctatagctgatatactatcgcagatactatcacagagatatacacaattagcccagctacataaacaaatggtcgtgttatattgtttgtgatttgcttt |
28833536 |
T |
 |
| Q |
101 |
ttcattaannnnnnngttac---ttgttgttctaacaaaattggcatcaaatggcgattaaccctggtgcgaaatcattttcttttataatccataacag |
197 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28833535 |
ttcattaatttttttgttacttgttgttgttctaacaaaattggcatcaaatggcgattaaccctggtgcgaaatcattttcttttataatccgtaacag |
28833436 |
T |
 |
| Q |
198 |
aagtccataacctggttaataacaaatctattg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28833435 |
aagtccataacctggttaataacaaatctattg |
28833403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University