View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_high_101 (Length: 206)
Name: NF19193_high_101
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_high_101 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 5e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 114 - 170
Target Start/End: Complemental strand, 40261405 - 40261349
Alignment:
| Q |
114 |
ttgccttgatctgtctaagtggtttgaatatactccattatagattgttagataggg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40261405 |
ttgccttgatctgtctaagtggtttgaatatactccattatagattgttagataggg |
40261349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 17 - 75
Target Start/End: Complemental strand, 40261473 - 40261415
Alignment:
| Q |
17 |
atatatgatattttatactgtgttcttattattcttttatgttgtcttcttatcctaac |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40261473 |
atatatgatattttatactgtgttcttattattcttttatgctgtcttcttatcctaac |
40261415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University