View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_high_102 (Length: 206)
Name: NF19193_high_102
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_high_102 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 13 - 188
Target Start/End: Original strand, 5512513 - 5512688
Alignment:
| Q |
13 |
cagagatagaattggatttggttagttgttttaatttagagaagaggttgggtagaaacttaattcaacgtactcttgaacttcactggatttttagtca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5512513 |
cagagatagaattggatttggttagttgttttaatttagagaagaggttgggtagaaacttaattcaacgtactcttgaacttcactggatttttagtca |
5512612 |
T |
 |
| Q |
113 |
ttacactacgtgataaagaaaagtaattcaacccaaattttacaaggattaaagtttaaatttcgttgtcaatttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5512613 |
ttacactacgtgataaagaaaagtaattcaacccaaattttacaaggattaaagtttaaatttcgttgtcaatttt |
5512688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University