View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_high_57 (Length: 310)
Name: NF19193_high_57
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_high_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 72 - 271
Target Start/End: Original strand, 34366081 - 34366280
Alignment:
| Q |
72 |
acattctagcatgagacactcaaacacatggtggatgcatgatgatgttgcatgcgtacatgcatggtccactttgaaattaatgttttatagtatatat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || |
|
|
| T |
34366081 |
acattctagcatgagacactcaaacacatggtggatgcatgatgatgttgcatgcgtacatgcatggtccacttggaaattaatgttttatagtatacat |
34366180 |
T |
|
| Q |
172 |
tcaaattagttgtaatgcaagttttgataaatttttgatagatttgatattgtcttataattttggattaggtttaattaagtgaagattaggtctgcac |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34366181 |
tcaaattagttgtaatgcaagttttgataaatttttgatagatctgatgccatcttataattttggattaggtttaattgagtgaagattaggtctgcac |
34366280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University