View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_high_61 (Length: 302)
Name: NF19193_high_61
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_high_61 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 32372165 - 32372411
Alignment:
| Q |
1 |
cctcttttctattttgtctggctgtgtgatgctcttgttttgctctttgaaatgttgaattacttttttgttaactggtgttatattatgtatatgtgcc |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32372165 |
cctcttttctattttgcctggctgtgtgatgctcttgttttgctctttgaaatgttgaattacttttttgttaactggggttatattatgtatatgtgcc |
32372264 |
T |
 |
| Q |
101 |
atttaccggtgtttttaagtcattttttattatccatgaccgtggactgttacgagttcacaagtcaagtcttgattatgtagacaattttgattgctaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32372265 |
atttaccggtgtttttaagtcattttttattatccatgaccgtgtactcttacgagtttacaagtcaagtcctgattatgtagacaattttgattgctaa |
32372364 |
T |
 |
| Q |
201 |
gtttaaatggtgaaaagtatttgattctttcatgataatttaaaatga |
248 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
32372365 |
gtttaagtggtgaaaagtatttgattc-ttcatgatattttaaaatga |
32372411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 199 - 248
Target Start/End: Original strand, 32358745 - 32358794
Alignment:
| Q |
199 |
aagtttaaatggtgaaaagtatttgattctttcatgataatttaaaatga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32358745 |
aagtttaaatggtgaaaagtatttgattctttcatgatattttaaaatga |
32358794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University