View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_high_63 (Length: 297)
Name: NF19193_high_63
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_high_63 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 5e-25; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 146 - 249
Target Start/End: Complemental strand, 31087641 - 31087534
Alignment:
| Q |
146 |
atgtggtatattgctgtggttgtgacttgtgaatgaaaca----tgttaaatagcgcatatagtgtagtgtaatttgaacaatttgctagtcctatgata |
241 |
Q |
| |
|
|||||||||||| ||||| || | ||||||||||| |||| ||||||||||| | || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31087641 |
atgtggtatattcctgtgtttttaacttgtgaatggaacaatgttgttaaatagcccctaaagtgtagtgtaatttgaacaatttgctagtcctatgata |
31087542 |
T |
|
| Q |
242 |
tactattt |
249 |
Q |
| |
|
|||||||| |
|
|
| T |
31087541 |
tactattt |
31087534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 115 - 150
Target Start/End: Complemental strand, 31087707 - 31087672
Alignment:
| Q |
115 |
ctttaaagtttagcatatgaacaaattaacaatgtg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31087707 |
ctttaaagtttagcatatgaacaaattaactatgtg |
31087672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 246 - 280
Target Start/End: Complemental strand, 31086994 - 31086960
Alignment:
| Q |
246 |
attttgggtctatttgatgttttcacatttaaaca |
280 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
31086994 |
atttagggtctatttgatgttttcacatttaaaca |
31086960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University