View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_high_84 (Length: 248)
Name: NF19193_high_84
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_high_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 131 - 237
Target Start/End: Original strand, 37790967 - 37791073
Alignment:
| Q |
131 |
cattggtcgtgtaaaactattttacactccaatgaattcacactatgatgccactttttagactagtgcctaaagtttcttaacaaatatctattttatg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37790967 |
cattggtcgtgtaaaactattttacactccaatgaattcacactgtggtgccactttttagactagtgcctaaagtttcttaacaaatatctatttgttg |
37791066 |
T |
 |
| Q |
231 |
taatttt |
237 |
Q |
| |
|
||||||| |
|
|
| T |
37791067 |
taatttt |
37791073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 37790837 - 37790905
Alignment:
| Q |
1 |
tagttacccggactaaaggcataaaatatttgtacagggactnnnnnnncacataatataattgcatgg |
69 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||| |||| ||||||||||||||| |||| |
|
|
| T |
37790837 |
tagttaccaggactaaaagcataaaatatttgtacagagactaaaagaacacataatataattgtatgg |
37790905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University