View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_high_87 (Length: 242)
Name: NF19193_high_87
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_high_87 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 50235263 - 50235040
Alignment:
| Q |
1 |
gctggtgttgtaacctgaccggcaccggatgttggcacagctgctggtgttgcaacctcaccggcactggatgttgacacagctgcaggtgttgctggtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235263 |
gctggtgttgtaacctgaccggcaccggatgctggcacagctgctggtgttgcaacctcaccggcactggatgttgacacagctgcaggtgttgctggtt |
50235164 |
T |
 |
| Q |
101 |
ttgatagtgttgctggagttgccggagctgaagcaccaaccttaacaattggctgtgaaacctggagaattgaaacaacgcctggttcagcctcagtgct |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235163 |
ttgatagtgttgctggagttgctggagctgaagcaccaaccttaacaattggctgtgaaacctggagaattgaaacaacgcctggttcagcctcagtgct |
50235064 |
T |
 |
| Q |
201 |
ttgaacaagcgtggcatcgaaggt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50235063 |
ttgaacaagcgtggcatcgaaggt |
50235040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 40 - 95
Target Start/End: Complemental strand, 50235266 - 50235211
Alignment:
| Q |
40 |
gctgctggtgttgcaacctcaccggcactggatgttgacacagctgcaggtgttgc |
95 |
Q |
| |
|
||||||||||||| ||||| |||||||| ||||| || ||||||||| |||||||| |
|
|
| T |
50235266 |
gctgctggtgttgtaacctgaccggcaccggatgctggcacagctgctggtgttgc |
50235211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University