View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_high_94 (Length: 222)
Name: NF19193_high_94
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_high_94 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 12852064 - 12852269
Alignment:
| Q |
1 |
aggcataataaaccttgagtatgtcgtccaagccaagagtcttagaactttttccaaaaccctaattgttgatgttgtcgatcaaaagctctaattgata |
100 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
12852064 |
aggcataataaaccttgaggatgtagtccaagccaagagtcttagaactttttccaaaaccctaattgttattgttgtcgatcgaaagctctaattgata |
12852163 |
T |
 |
| Q |
101 |
aatgtgtgttaactcttg-gnnnnnnnatagacaaatgtatgttataggttaatttgtacggttcgagaggaatgtgttaaagcaacatcaatcgaactt |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12852164 |
aatgtgtgttaactcttgattttttttatagacaaatgtatgttataggttaatttgtacggttcgagaggaatgtgttaaagcaacatcaatcgaactt |
12852263 |
T |
 |
| Q |
200 |
tgaact |
205 |
Q |
| |
|
|||||| |
|
|
| T |
12852264 |
tgaact |
12852269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University