View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_high_96 (Length: 219)
Name: NF19193_high_96
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_high_96 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 14426878 - 14426666
Alignment:
| Q |
1 |
tgacagatcaggtctaaacatgcactcaaattttaaaatgaggtaaacaaattaagaattttaccaagtatttgattatgaaacttttcttgtcttggat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14426878 |
tgacagatcaggtctaaacatgcactcaaattttaaaatgaggtaaacaaattaagaattttaccaagtatttgattatgaaacttttcttgtcttgga- |
14426780 |
T |
 |
| Q |
101 |
gtcttgtcatcccatctctttacttcnnnnnnntttgaacnnnnnnntgtgaggataattaagtaaacaaatgccaagagtggtagtttggagcaaagac |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14426779 |
----tgtcatcccatctctttacttcaaaaaaatttgaacaaaaaaatgtgaggataattaagtaaacaaatgccaagagtggtagtttggagcacagac |
14426684 |
T |
 |
| Q |
201 |
gggaggagtgactgtcca |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14426683 |
gggaggagtgactgtcca |
14426666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University