View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_103 (Length: 210)
Name: NF19193_low_103
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_103 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 33884378 - 33884202
Alignment:
| Q |
16 |
aaaatatgcagtaaactagctgaccattcctgatctttcagcatgttttcttgccactcttgttgaaacttctgcaacagaagtgtcaatagtttttgca |
115 |
Q |
| |
|
|||||||||||||||| ||||||| || |||||||||||| || | ||||||||||| ||| ||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33884378 |
aaaatatgcagtaaacaagctgactatacctgatctttcaacacatcttcttgccactgttgctgaaacttctgcaacagaagtgtcaatagcttttgca |
33884279 |
T |
|
| Q |
116 |
attcaggcagaatttcactgcgaaacaactttggagtatcatccttgcaggtattttcataaacacatcttctgatt |
192 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||| |||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
33884278 |
attcaggcagaacttcactgggaaacaactttggataatcatccttgcaggtattttcataaacacacctcctgatt |
33884202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University