View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_105 (Length: 207)
Name: NF19193_low_105
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_105 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 16 - 187
Target Start/End: Original strand, 31605354 - 31605525
Alignment:
| Q |
16 |
atgaaaatgttataaaaattatttacttattaacgaggcaaaaagagactcttgagatagacaatcgtcttatattttttaaaataatgatatttattga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| ||| | |||||||||||||||||||||||||||||| | |
|
|
| T |
31605354 |
atgaaaatgttataaaaattatttacttattaacgaggcgaaaagagactcttgaaatagataattgccttatattttttaaaataatgatatttattaa |
31605453 |
T |
|
| Q |
116 |
ccaaaatagtaatcaaaatattctagtgcctctggtgtctgatttagtgattgaattttcgaatagattgtt |
187 |
Q |
| |
|
|||| ||| ||||||||||||||||||| |||| | ||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
31605454 |
ccaacataataatcaaaatattctagtgtctctagcgtcggatttagtgattgaattttcaaatggattgtt |
31605525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University