View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_32 (Length: 396)
Name: NF19193_low_32
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 16 - 329
Target Start/End: Complemental strand, 17063473 - 17063161
Alignment:
| Q |
16 |
atgtgaagaacaacgtcaaacaaacattttgtgaaagcagttttccttaccaccacatgagatgactgtcttttcacattgtattttgctaaactcttgt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
17063473 |
atgtgaagaacaacgtcaaacaaacattttgtgaaagcagttttccttaccaccacatgagatgactgtcttttcacattgtattttgctaaactctcgt |
17063374 |
T |
 |
| Q |
116 |
act----tttcaccacatgagagtacttgtgacataattaatcaaggaaattacactcgttagatccattaatcggtgtcagagacgacaaagatatata |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||| || |
|
|
| T |
17063373 |
actgccttttcaccacatgagagtacttgtgacataattaatcaaggaaattacactcgttggatccattaatcggtattggagacgacaaagatattta |
17063274 |
T |
 |
| Q |
212 |
ggtcacgatatatatgtccaacagatgcaccgatgtgggatcgatttatcatagagatcgcaaactagcagatcaataggacacaaagacaaggaaattc |
311 |
Q |
| |
|
||||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17063273 |
ggtcacgatatgt-----caacagatgcaccgatgcgggatcgatttatcatagagatcgcaaaccagcagatcaataggacacaaagacaaggaaattc |
17063179 |
T |
 |
| Q |
312 |
agatataataccaggaaa |
329 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
17063178 |
agatataataccaggaaa |
17063161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 170
Target Start/End: Original strand, 21185270 - 21185303
Alignment:
| Q |
137 |
cttgtgacataattaatcaaggaaattacactcg |
170 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
21185270 |
cttgtgacataattaatcaaggaaatcacactcg |
21185303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University