View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_45 (Length: 359)
Name: NF19193_low_45
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 20 - 239
Target Start/End: Complemental strand, 32831816 - 32831597
Alignment:
| Q |
20 |
tgatgaagattagtgattgatcaaacaaactggtgataagattttgtctgtaaattctgatagttttcgactttcaccatgatgacttgtgttgatcttt |
119 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||| |
|
|
| T |
32831816 |
tgatgaagattagtgattgattaaacgaactggtgataagattttgtctgtaaattctgatagtttttgactttcactatgatgacttgtgttgattttt |
32831717 |
T |
 |
| Q |
120 |
tatggcatgtgtttattgaactggtttcaacttgcaaatttgcatgcgttagtgaggtttctatgactttgtttttcatatctgctcagtcttacggttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32831716 |
tatggcatgtgtttattgaactggtttcaacttgcaaatttgcatgcgttagtgaggtttctatgactttgtttttcatatctgctcagtcttacggttt |
32831617 |
T |
 |
| Q |
220 |
ggtgctccctaattttcctg |
239 |
Q |
| |
|
||||||||||||||| |||| |
|
|
| T |
32831616 |
ggtgctccctaatttacctg |
32831597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University