View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_55 (Length: 322)
Name: NF19193_low_55
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_55 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 312
Target Start/End: Complemental strand, 13015956 - 13015656
Alignment:
| Q |
18 |
aggatgggcctgtttgtatagattctttgggacctttccttttgctgtacttttctgcattaatcctttcttgctgctggttttgttcagtatgcatggg |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13015956 |
aggatgggtctgtttgtatagattctttggggcctttccttttgctgtacttttctgcattaatcctttcttgctgctggttttgttcagtatgcatggg |
13015857 |
T |
 |
| Q |
118 |
atgctagccttttagcactgctggtgcgtggcttttatacaagctgattc------nnnnnnnnnngacgccttgatcctagcattataacagtgggatt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13015856 |
atgctagccttttagcactgctggtgcgtggcttttatataagctgattcaaaaaaaaaaaaaaatgacgccttgatcctagcattataacagtgggatt |
13015757 |
T |
 |
| Q |
212 |
tcagcttgtgttttttcctctcgtgcatcaacttgcatattatgcgtttgtgcttctacttgtgaatccgtttatggctttatgcattcatacaacctat |
311 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13015756 |
tcaacttgtgttttttcctctcgtgcatcaacttgcatattatgcgtttgtgcttttacttgtgaatccgtttatggctttatgcattcatacaacctat |
13015657 |
T |
 |
| Q |
312 |
g |
312 |
Q |
| |
|
| |
|
|
| T |
13015656 |
g |
13015656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University