View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_63 (Length: 306)
Name: NF19193_low_63
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 20 - 111
Target Start/End: Complemental strand, 31235200 - 31235109
Alignment:
| Q |
20 |
ggtgggttgtggtgctgaatttggagaattgtggtggtcttgtgtgttttcctgtgttctgagcgtgtgggtagaaaggggaagaacgatgg |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31235200 |
ggtgggttgtggtgctgaatttggagaattgtggtggtcttgtgtgttttcctgtgttctgagcgtgtgggtagaaaggggaagaacaatgg |
31235109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 174 - 298
Target Start/End: Complemental strand, 31235046 - 31234922
Alignment:
| Q |
174 |
ggctttacttttcccacctattttctcacctattgatttctcgcgcgcccaannnnnnnncaaaaatgtcatttagattttcagattttgtaatccgaat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||| | ||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
31235046 |
ggctttacttttcccacctattttctcaccaattgatttttcgcgcgccctattttttt-caaaaatgtcatttagattttcaaattttttaatccgaac |
31234948 |
T |
 |
| Q |
274 |
gggtgttttcc-tttgttattcattt |
298 |
Q |
| |
|
||||||||||| |||||||||||||| |
|
|
| T |
31234947 |
gggtgttttccttttgttattcattt |
31234922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 234 - 292
Target Start/End: Original strand, 4649952 - 4650010
Alignment:
| Q |
234 |
caaaaatgtcatttagattttcagattttgtaatccgaatgggtgttttcctttgttat |
292 |
Q |
| |
|
||||||||| || ||||||||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
4649952 |
caaaaatgttcttgagattttcagattttaaaattcgaattggtgttttcctttgttat |
4650010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University