View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_72 (Length: 283)
Name: NF19193_low_72
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_72 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 16 - 143
Target Start/End: Complemental strand, 2694008 - 2693881
Alignment:
| Q |
16 |
atcaccgtaggtcaaaaggaggagtttattttttaaactctgcgactgtgtgagagttatttctttttggtggtcggaagctcaaaaactaggttttgat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2694008 |
atcaccgtaggtcaaaaggaggagtttattttttaaactctgcgaccgtgtgagagttatttctttttggtggtcggaagctcaaaaactaggttttgat |
2693909 |
T |
 |
| Q |
116 |
tttgatattcatcaatggtgggttaagc |
143 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
2693908 |
tttgatattcatcaatggtgggttaagc |
2693881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 210 - 239
Target Start/End: Complemental strand, 2693810 - 2693781
Alignment:
| Q |
210 |
atgcatcatacaaaatcatttatgaaatag |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2693810 |
atgcatcatacaaaatcatttatgaaatag |
2693781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University