View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_73 (Length: 278)
Name: NF19193_low_73
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_73 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 45 - 261
Target Start/End: Complemental strand, 40453217 - 40453001
Alignment:
| Q |
45 |
aaggatggttgatactagtgaatgcttttaaacttcaattcctttgggattttctgtaaagagtgcttgaaatggagagaaagaaaacagaaagagatag |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40453217 |
aaggatggttgatactagtgaatgcttttaaacttcaattcctttgggattttctgtaaagagtgcttgaaatggagagaaagaaaacagaaagagatag |
40453118 |
T |
|
| Q |
145 |
gtatggaagtggaaaattcagaattcagtttagattctttgtttaagtagagtttaattggcatatgtactaaggcaagtgtaaattagttttacactta |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40453117 |
gtatggaagtggaaaattcagaattcagtttagattctttgtttaagtagagtttaattggcatatgtactaaggcaagtgtaaattagttttacactta |
40453018 |
T |
|
| Q |
245 |
cattttgatcccacttt |
261 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40453017 |
cattttgatcccacttt |
40453001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 49
Target Start/End: Complemental strand, 40453254 - 40453224
Alignment:
| Q |
19 |
atggtttggttagagattctgtagtgaagga |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40453254 |
atggtttggttagagattctgtagtgaagga |
40453224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University