View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_78 (Length: 261)
Name: NF19193_low_78
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_78 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 1 - 170
Target Start/End: Complemental strand, 40879853 - 40879689
Alignment:
| Q |
1 |
tgatgcatgaagagataggtgaagcagaagttgttgctttaatttcaataaatcttctatgttggaacaagtttattgtttttagaataagaagaagtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40879853 |
tgatgcatgaagagataggtgaagcaaaagttgtcgc-----tttcaataaatcttctatgttggaacaagtttattgtttttagaataagaagaagtat |
40879759 |
T |
 |
| Q |
101 |
taaagagaaaggagagaattcacttttggattgaaaggatcaagtttattcattccaatatattgtgaga |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40879758 |
taaagagaaaggagagaattcacttttggattgaaaggatcaagtttattcattccaatatattgtgaga |
40879689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 166 - 242
Target Start/End: Complemental strand, 40879635 - 40879559
Alignment:
| Q |
166 |
tgagaagtgtgataaaattactccaagaggccaccaaattgtgaaagaggtgaaacatatataatcaatggagatcc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40879635 |
tgagaagtgtgataaaattactccaagaggccaccaaattgtgaaagaggtgaaacatatataatcaatggagatcc |
40879559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University