View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19193_low_80 (Length: 256)

Name: NF19193_low_80
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19193_low_80
NF19193_low_80
[»] chr1 (1 HSPs)
chr1 (93-227)||(5550785-5550919)


Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 93 - 227
Target Start/End: Original strand, 5550785 - 5550919
Alignment:
93 aaggtgaagtgaacgtggaccttataaagacacgaggggtgggaaattggaaaatggattaattttaaattattttaattatagatatttattatcataa 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5550785 aaggtgaagtgaacgtggaccttataaagacacgaggggtgggaaattggaaaatggattaattttaaattattttaattatagatatttattatcataa 5550884  T
193 tcgatgttgattaggtaagaaattatagcgtggga 227  Q
    |||||||||||||||||||||||||||||||||||    
5550885 tcgatgttgattaggtaagaaattatagcgtggga 5550919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University