View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_85 (Length: 250)
Name: NF19193_low_85
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 54989113 - 54988877
Alignment:
| Q |
1 |
cttccctgtacatgtcaaaatacattataatgctggtaaagtatggcaaaggagttgaagtatgagcaacttgaattatagaacaagttgcttactgtga |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54989113 |
cttccctgcacatgtcaaaatacattataatgctggtaaagtatggcaaaggagttgaagtatgagcaacttgaattatagaacaagttgcttactgtga |
54989014 |
T |
 |
| Q |
101 |
ttggggacttagccaacctccatatctgtcctcaagttcttgagggaaatccaagtgaaataatgtaacaaacggttggatccctgcgaattgtataatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54989013 |
ttggggacttagccaacctccatatctgtcctcaagttcttgagggaaatccaagtgaaataatgtaacaaacggttggatccctgcgaattgtataatt |
54988914 |
T |
 |
| Q |
201 |
acaggttaagctaattcaacggttacacctcctgttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
54988913 |
acaggttaagctaattcaacggttacacctcttgttc |
54988877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 90 - 147
Target Start/End: Complemental strand, 55002530 - 55002473
Alignment:
| Q |
90 |
gcttactgtgattggggacttagccaacctccatatctgtcctcaagttcttgaggga |
147 |
Q |
| |
|
|||||||||||||||||||||||| | || ||||||||||| || |||||||| |||| |
|
|
| T |
55002530 |
gcttactgtgattggggacttagcaaccccccatatctgtcttctagttcttgtggga |
55002473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 91 - 151
Target Start/End: Complemental strand, 7920901 - 7920841
Alignment:
| Q |
91 |
cttactgtgattggggacttagccaacctccatatctgtcctcaagttcttgagggaaatc |
151 |
Q |
| |
|
|||||||||| | ||||||||||||||| | |||||||| ||||||||||||| ||||| |
|
|
| T |
7920901 |
cttactgtgactctggacttagccaaccttcgtatctgtctccaagttcttgaggtaaatc |
7920841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University