View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_91 (Length: 238)
Name: NF19193_low_91
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_91 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 45373956 - 45374171
Alignment:
| Q |
1 |
agaggaactcggttatgatgcatggagaggttatggttttgtgtgaagtcgagggtgattgttgggaagggctgagaagctgatagggttgaggttgcga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45373956 |
agaggaactcggttatgatgcatggagaggttatggttttgtgtgaagtcgagggtgattgttgggaagggctgagaagctgatagggttgaggttgcca |
45374055 |
T |
|
| Q |
101 |
ttgttgcatagggaaatgaattagataaatatcctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagcattgctgcagctgctga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45374056 |
ttgttgcatagggaaatgaattagataaataacctgttgctgattcctttcttagtgttgatgaggttgaacttgatagcagcattgctgcagctgctga |
45374155 |
T |
|
| Q |
201 |
tgttgtgtgtgctatg |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45374156 |
tgttgtgtgtgctatg |
45374171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University