View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19193_low_97 (Length: 226)
Name: NF19193_low_97
Description: NF19193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19193_low_97 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 11 - 97
Target Start/End: Original strand, 2319620 - 2319706
Alignment:
| Q |
11 |
tagattatactatttgaaccaatatatacgtcgtgtttaaccactttttcttatttttcattttcaaaatttagcctaagaacttcc |
97 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||| ||||||| ||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2319620 |
tagattatactatttgaaccactatatatgtcgtgcttaaccagttttttttattttccattttcaaaatttagcctaagaacttcc |
2319706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University