View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19194_high_6 (Length: 361)
Name: NF19194_high_6
Description: NF19194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19194_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 4e-97; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 127 - 347
Target Start/End: Original strand, 50573252 - 50573472
Alignment:
| Q |
127 |
gaccggtatcatgcaaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50573252 |
gaccggtatcatgcaaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaacaatt |
50573351 |
T |
 |
| Q |
227 |
tgtgnnnnnnnctcgtaatacttgattccttagcctttatttatgctttaggatttcaagattcgaagccatatgaatgtcaacttccgcagatggttgg |
326 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||| |
|
|
| T |
50573352 |
tgtgtttttttctcgtaatacttgattcctttgcctttatttatgctttaggatttcaagattcgcagccagatgaatgtcaacttccgcaaatggttgg |
50573451 |
T |
 |
| Q |
327 |
atggtcttgcgtgttcctatg |
347 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
50573452 |
atggtcttgcgcgttcctatg |
50573472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 50573109 - 50573177
Alignment:
| Q |
1 |
acattcctactatgtatctatattatcgatgtcctccacttgaagttaattacactggaaaactaagcc |
69 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50573109 |
acattcctactatgtatctatattattgatgtcctccactcgaagttaattacactggaaaactaagcc |
50573177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 50562094 - 50562138
Alignment:
| Q |
245 |
tacttgattccttagcctttatttatgctttaggatttcaagatt |
289 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||| ||||| |
|
|
| T |
50562094 |
tacttgattccttcggctttacttatgctttaggatttccagatt |
50562138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 132 - 222
Target Start/End: Original strand, 50567427 - 50567514
Alignment:
| Q |
132 |
gtatcatgcaaaagcttggttttccggctaaatttgaggtacaacttcttctctttcagattatccacttcactggaattgtttcatcaac |
222 |
Q |
| |
|
||||||| |||||| ||||||||| | |||||| ||||||||| ||| |||||||| |||||| ||| ||| ||||||||||||||| |
|
|
| T |
50567427 |
gtatcatacaaaagtgtggttttcccgtcaaatttaaggtacaacatctactctttcatattatc---ttcgctgaaattgtttcatcaac |
50567514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University