View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19194_low_16 (Length: 258)
Name: NF19194_low_16
Description: NF19194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19194_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 240
Target Start/End: Original strand, 30963621 - 30963850
Alignment:
| Q |
11 |
caaagggaaggcatacgcaaacttcatcttagttttatttattaacatggcgcatatgatgcataaaattggagttgtattgaaaataaaagtttgtcaa |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30963621 |
caaagggaaggcataagcaaacttcatcttagttttgtttattaacatggcgcatatgatgcataaaattggagttgtattgaaaataaaagtttgtcaa |
30963720 |
T |
|
| Q |
111 |
attgacgcgtaaatcaaatgcgacccaccaaatgaaattgaaattagtgtgcctgcctagaaatttcaataaacgttcattgatatagttacaatcttaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30963721 |
attgacgcgtaaatcaaatgcgacccaccaaatgaaattgaaattagtgtgcctgcctagaactttcaataaacgttcattgatatagttacaatcttat |
30963820 |
T |
|
| Q |
211 |
ctcaaccccttttcgtcgttgaataagttg |
240 |
Q |
| |
|
||||||||||||| |||||| || |||||| |
|
|
| T |
30963821 |
ctcaacccctttttgtcgtttaacaagttg |
30963850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 195 - 236
Target Start/End: Original strand, 30963902 - 30963943
Alignment:
| Q |
195 |
atagttacaatcttaactcaaccccttttcgtcgttgaataa |
236 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||| ||||| |
|
|
| T |
30963902 |
atagttacaatcttaactcaacccttttttgtcgtttaataa |
30963943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University