View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19194_low_23 (Length: 241)
Name: NF19194_low_23
Description: NF19194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19194_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 71 - 223
Target Start/End: Complemental strand, 45102736 - 45102594
Alignment:
| Q |
71 |
attattctaatttaatttattactagtaacgctcatgttagagttactagtaataattctcacattattagtacaaataattctaacattatttatatcg |
170 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45102736 |
attattcgaatttaatttattactagtaacgctcatgttagagttactagtaataattctcacattattagtacaaataattctaaaattatttata--- |
45102640 |
T |
|
| Q |
171 |
ttcctttcatacgatctagtatgattggaatatacagtaataaatgctaactg |
223 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45102639 |
ttc-------acgatctagtatgattggaatatacagtaataaatgctaactg |
45102594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University