View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19194_low_27 (Length: 223)
Name: NF19194_low_27
Description: NF19194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19194_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 208
Target Start/End: Original strand, 32008445 - 32008635
Alignment:
| Q |
19 |
aagatataatactttctatgttagagaaaaatggtatttttgtagataaaaggttgttttatggtttagttaatgataaaaaa--tcatgtctttttaca |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
32008445 |
aagatataatattttctatgttagagaaaaatggtattttcatagataaaaagttattttatggtttagttaatcataaaaaaaatcatgt-tttttaca |
32008543 |
T |
|
| Q |
117 |
gtctcgtacgtactctcatggtttatttataaatcaaacagtatgcaaaaaagttgtctaatctcttactccctcttgtctcaattataaac |
208 |
Q |
| |
|
|||||||||||||| | ||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32008544 |
gtctcgtacgtactgttatgatttatttataaatcaaaccgtatgcaaaaaagttgtctaatctcttactccctcttgtctcaattataaac |
32008635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University