View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19195_high_14 (Length: 277)
Name: NF19195_high_14
Description: NF19195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19195_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 94 - 202
Target Start/End: Complemental strand, 4648467 - 4648359
Alignment:
| Q |
94 |
acgaagaattgtgatggatggatatgggataaatggaaggaaaaagaacataaaagtatgtttatattacgaggtaagctctaactgttatcaaatgaga |
193 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||| |||||||||||||||||||||||||||||| ||||||| ||| ||||| |||| | |||||||| |
|
|
| T |
4648467 |
acgaagaattgtgatggatgtatattggacaaaaggaaggaaaaagaacataaaagtatgtttacattacgatgtacattctaagtgttgttaaatgaga |
4648368 |
T |
|
| Q |
194 |
agacaaaaa |
202 |
Q |
| |
|
|||||||| |
|
|
| T |
4648367 |
ggacaaaaa |
4648359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 4656510 - 4656451
Alignment:
| Q |
1 |
cacacacattagaataattgcacaccggtccggtgatcattggttcattgttatctgcat |
60 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4656510 |
cacacacattagaataattgcacaccgttccggtgatcattggttcattgttatctgcat |
4656451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University