View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19195_low_11 (Length: 292)
Name: NF19195_low_11
Description: NF19195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19195_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 17 - 281
Target Start/End: Complemental strand, 26630222 - 26629966
Alignment:
| Q |
17 |
caaacattgttgactcgttgattgttcattcaacaacttctacaatttggaaactaagcgttagatatgtgaaactactaattacatcccttatacttag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || | ||| ||||| ||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
26630222 |
caaacattgttgactcgttgattgttcattcaacaactcctgcgattaggaaattaagcgttagagatgtgaaactactaattacattccttata----- |
26630128 |
T |
 |
| Q |
117 |
ccattcattatatccataagaacggatttcataagaagaatatcgaaggaagggacatggctggaaaattacttgtgaatttgttggtgaatttgctact |
216 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26630127 |
---ttcattatatccataagaatggattttataagaagaatatcgaaggaagggacatggctggaaaattacttgtgaaattgttggtgaatttgctacc |
26630031 |
T |
 |
| Q |
217 |
gaaggtatctctaaaccaggaatgtttaaaacaaagttttgctttctctcttctgtttgtttcat |
281 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||| | ||||||||||||||||||||||||||| |
|
|
| T |
26630030 |
gaaggaatctctaaaccaggaatgtttacaacaaattcttgctttctctcttctgtttgtttcat |
26629966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University