View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19195_low_14 (Length: 277)

Name: NF19195_low_14
Description: NF19195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19195_low_14
NF19195_low_14
[»] chr5 (2 HSPs)
chr5 (94-202)||(4648359-4648467)
chr5 (1-60)||(4656451-4656510)


Alignment Details
Target: chr5 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 94 - 202
Target Start/End: Complemental strand, 4648467 - 4648359
Alignment:
94 acgaagaattgtgatggatggatatgggataaatggaaggaaaaagaacataaaagtatgtttatattacgaggtaagctctaactgttatcaaatgaga 193  Q
    |||||||||||||||||||| |||| ||| ||| |||||||||||||||||||||||||||||| ||||||| |||   ||||| |||| | ||||||||    
4648467 acgaagaattgtgatggatgtatattggacaaaaggaaggaaaaagaacataaaagtatgtttacattacgatgtacattctaagtgttgttaaatgaga 4648368  T
194 agacaaaaa 202  Q
     ||||||||    
4648367 ggacaaaaa 4648359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 4656510 - 4656451
Alignment:
1 cacacacattagaataattgcacaccggtccggtgatcattggttcattgttatctgcat 60  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
4656510 cacacacattagaataattgcacaccgttccggtgatcattggttcattgttatctgcat 4656451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University