View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19195_low_21 (Length: 236)
Name: NF19195_low_21
Description: NF19195
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19195_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 27 - 221
Target Start/End: Complemental strand, 11834087 - 11833893
Alignment:
| Q |
27 |
accatagaccagtgttgtaaacaaaagcttttatatattcccatatttttggtgcagctatcacactggcctattagagaaagaaacatatttaggaaat |
126 |
Q |
| |
|
||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
11834087 |
accattgaccactgttgttcacaaaagcttttatatattcccatatttttggtgcagctatcatgctggcctattagaaaaagaaacatatttatgaaat |
11833988 |
T |
 |
| Q |
127 |
ttaaattggttataacagtttatgctggtttgaaaaaactgaactttcatttgtaaagtttcagatttatttctagaaaaatttacaaaataaac |
221 |
Q |
| |
|
|||||||| ||||| |||||| |||||||||||||||||||||||| || |||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
11833987 |
ttaaattgattatattagtttaggctggtttgaaaaaactgaacttttataagtaaagtttcagatttatttctagtaaaatttgcaaaataaac |
11833893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University