View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19197_high_14 (Length: 308)
Name: NF19197_high_14
Description: NF19197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19197_high_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-141; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 17 - 305
Target Start/End: Original strand, 31434105 - 31434393
Alignment:
| Q |
17 |
tgaggtacatgacaccacaatggtttaaataatcagatatttatatggcacggtcatacttttaaattattgtaagaagtcacaagtgatcttgtttgta |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31434105 |
tgaggtccatgacaccacaatggtttaaataatcagatatttatatggcacggtcatacttttaaactattgtaagaagtcacaagtgatcttgtttgtg |
31434204 |
T |
|
| Q |
117 |
aggaaaaaccctagtgcatgaaattaactgataattaattcaagatcaattatttgtctaatgtttttgaacatgcaggagggtggtcaagtgcaccaga |
216 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31434205 |
aggcaaaaccctagtgcatgaaattaactgataattaattaaacatcaattatttgtctaatgtgtttgaacatgcaggagggtggtcaagtgcaccaga |
31434304 |
T |
|
| Q |
217 |
cggtccatatgcgtggggatattgctttgtcaatgaacgtaatgcccaggaaaaaagatactatggcagagggcctattcatctcactc |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
31434305 |
cggtccatatgcgtggggatattgctttgtcaatgaacgtaatgcccaggaaaaaagatactatggcagagggccaattcagctcactc |
31434393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 177 - 248
Target Start/End: Original strand, 31429353 - 31429424
Alignment:
| Q |
177 |
atgtttttgaacatgcaggagggtggtcaagtgcaccagacggtccatatgcgtggggatattgctttgtca |
248 |
Q |
| |
|
|||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31429353 |
atgtttatgaacatgcaggagggtggccaagtgcaccagacggaccatatgcgtggggatattgctttgtca |
31429424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 176 - 255
Target Start/End: Original strand, 31444403 - 31444482
Alignment:
| Q |
176 |
aatgtttttgaacatgcaggagggtggtcaagtgcaccagacggtccatatgcgtggggatattgctttgtcaatgaacg |
255 |
Q |
| |
|
||||||||||| ||| |||||||||| ||| |||||| ||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
31444403 |
aatgtttttgagaatgtaggagggtggccaactgcacctgacggtccatacgcgtggggatattgctttgtgaatgaacg |
31444482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 269 - 305
Target Start/End: Original strand, 31429484 - 31429520
Alignment:
| Q |
269 |
aaaagatactatggcagagggcctattcatctcactc |
305 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
31429484 |
aaaagatactatggcagaggacctattcaactcactc |
31429520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University