View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19197_high_26 (Length: 233)
Name: NF19197_high_26
Description: NF19197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19197_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 147 - 216
Target Start/End: Complemental strand, 38759157 - 38759088
Alignment:
| Q |
147 |
ctggtgttgttgaatttataggcgtgtgcacttactggtggatttgcacctcttatgccagcagttgatt |
216 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38759157 |
ctggtgttgttgaatttataggtgtgtgcacttactggtggatttgcacctcttatgccagcagttgatt |
38759088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 38759287 - 38759224
Alignment:
| Q |
17 |
aatatcctcggaggattgcccaatttttccttcccacttcaagagaagaattctagcgaggtac |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38759287 |
aatatcctcggaggattgcccaatttttccttcccacttcaagagaagaattctagcgaggtac |
38759224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University