View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19197_low_13 (Length: 316)
Name: NF19197_low_13
Description: NF19197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19197_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 300
Target Start/End: Original strand, 17574319 - 17574603
Alignment:
| Q |
16 |
atatgattttgatgaataagtcaggtaaattgtaccaagtccgggaagttcccaagtattggtctaaccatgcttccttccttgtctttaacaacagagc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
17574319 |
atatgattttgatgaataagtcaggtaaattgtaccaagtccgggaagttcccaagtattggtctaaccatgcttccttccttgtctttaacaacataac |
17574418 |
T |
 |
| Q |
116 |
atgtatactcttctaattgaaaaatattgaatgtatagaatgtgatgcatagtaataacgagtaatgacnnnnnnngttttgttataattttaggttgaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
17574419 |
atgtatactcttctaattgaaaaatattgaatgtataaaatgtgatgtatagtaataatgagtaatgactttttttgttttgttataattttaggttgaa |
17574518 |
T |
 |
| Q |
216 |
aacagtccttatgatccaaacgtgatggttttcatggattacagagactatatgaagaacaatgttcaaagtctagaagctaaat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17574519 |
aacagtccttatgatccaaacgtgatggttttcatggattacagagactatatgaagaacaatgttcaaagtctagaagctaaat |
17574603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University