View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19197_low_22 (Length: 242)
Name: NF19197_low_22
Description: NF19197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19197_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 2399655 - 2399439
Alignment:
| Q |
16 |
atgaagaatgaagtcttcaatagtactcagacccaagcataaccgtgtcatgatttgcttggatcctgccacgataaaattcgtacacaatacaatacta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||| |
|
|
| T |
2399655 |
atgaagaatgaagtcttcaatagtactcaaacccaagcataaccgtgtcatgatttgcttggatcctgccacgatgaaattcatacacaatacagtacta |
2399556 |
T |
 |
| Q |
116 |
caacctgaaccaaaagccgcaccccaatgttgcttccgatagctcctccacattttgacccaaaatcgtgtcacggtttttgcctccataaccataacag |
215 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || |
|
|
| T |
2399555 |
caacctgaaccaaaagccgcacctcaatgttgcttccaatagctcctccacattttgacccaaaatcgtgtcacgatttttgcctccataaccataaaag |
2399456 |
T |
 |
| Q |
216 |
caaatcatgcagagtaa |
232 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
2399455 |
caaatcatgcagggtaa |
2399439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University