View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19197_low_26 (Length: 233)

Name: NF19197_low_26
Description: NF19197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19197_low_26
NF19197_low_26
[»] chr1 (2 HSPs)
chr1 (147-216)||(38759088-38759157)
chr1 (17-80)||(38759224-38759287)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 147 - 216
Target Start/End: Complemental strand, 38759157 - 38759088
Alignment:
147 ctggtgttgttgaatttataggcgtgtgcacttactggtggatttgcacctcttatgccagcagttgatt 216  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
38759157 ctggtgttgttgaatttataggtgtgtgcacttactggtggatttgcacctcttatgccagcagttgatt 38759088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 38759287 - 38759224
Alignment:
17 aatatcctcggaggattgcccaatttttccttcccacttcaagagaagaattctagcgaggtac 80  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38759287 aatatcctcggaggattgcccaatttttccttcccacttcaagagaagaattctagcgaggtac 38759224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University