View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19197_low_8 (Length: 400)
Name: NF19197_low_8
Description: NF19197
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19197_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 5e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 312 - 382
Target Start/End: Original strand, 31610283 - 31610353
Alignment:
| Q |
312 |
aacaccaaaaaagtataatggcttctgcgatattgttttttgataattaagcaattattatcagtgcatca |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31610283 |
aacaccaaaaaagtataatggcttctgcgatattgttttttgataattaagcaattattatcagtgcatca |
31610353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 176 - 220
Target Start/End: Original strand, 42971442 - 42971487
Alignment:
| Q |
176 |
gaaatgaggtatcacttggttgcag-ccctcacaccctttcttgaa |
220 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |||||||| |
|
|
| T |
42971442 |
gaaatgaggtatcacttggttgcagcccctctcacccattcttgaa |
42971487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University