View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19198_high_41 (Length: 238)
Name: NF19198_high_41
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19198_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 5 - 181
Target Start/End: Original strand, 6282094 - 6282271
Alignment:
| Q |
5 |
tttatgtcatactaatataaatgtggcatgatagagtcttgactaaccttcaatattatggcatcacctgttgggacacttttaaacatgtctccttcaa |
104 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6282094 |
tttatgtcatattaatataaatatggtatgataaagtcttgactaaccttcaatattatggcatcacctgttgggacacttttaaacatgtctccttcaa |
6282193 |
T |
|
| Q |
105 |
tttgctcaattccttcataaaatcgataattcactca-ttagtgacaaacatgatatacatattaaagacattagggt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6282194 |
tttgctcaattccttcataaaatcgataattcactcatttagtgacaaacatgatatacatattaaagacattagggt |
6282271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University