View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19198_low_18 (Length: 396)
Name: NF19198_low_18
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19198_low_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 21 - 386
Target Start/End: Original strand, 33402348 - 33402713
Alignment:
| Q |
21 |
tgagaccgtgtcatctcgattatgtcaggaaggccaggaacaatgaaaggttctttgtctgaactcagattctctaacacaacatgttttctcgtatttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33402348 |
tgagaccgtgtcatctcgattatgtcaggaaggccaggaacaatgaaaggttctgagtctgaactcagattctctaacacaacatgttttctcgtatttt |
33402447 |
T |
|
| Q |
121 |
caatgacacagcgcgggaaacacccgttaccattgaagacaattcttggaattttgagttcatcgatgatgtcgccagcccaacgatgaaacatgtcaac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33402448 |
caatgacacagcgcgggaaacacccgttaccattgaagacaattcttggaattttgagttcatcgatgatgtcgccagcccaacgatgaaacatgtcaac |
33402547 |
T |
|
| Q |
221 |
aactataccgtccggtctgtgttggactaggaactgtttcagaggttcaagcagaatcgaggtatcaatcatgggaccagaagacatgtcggtgtcggtt |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| ||| |
|
|
| T |
33402548 |
aactataccgtccggtctgtgttggactaggaactgtttcagaggttcaaggagaatcgaggtatcgatcatgggaccagcagacatgtcggtgtcagtt |
33402647 |
T |
|
| Q |
321 |
acttcagtgttttcaggggtggtgagaatctgaatggtgatgggatgattggatttttggtctctg |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33402648 |
acttcagtgttttcaggggtggtgagaatctgaatggtgatgggatgattggatttttggtctctg |
33402713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University