View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19198_low_33 (Length: 256)
Name: NF19198_low_33
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19198_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 27522447 - 27522199
Alignment:
| Q |
1 |
cgtgcatcaaatattttttaaacaaatcgctccttctttctctctacccaattgtaacgaatgaatcatgatattaattgcaaatannnnnnn-caatca |
99 |
Q |
| |
|
|||||||||| | |||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
27522447 |
cgtgcatcaatttttttttaaacgaatcactccttctttctctctacccaattgtaacgaatgaatcatgacattaattgcaaatattttttttcaatca |
27522348 |
T |
 |
| Q |
100 |
aaacttattacaagttaacgaatggccttaatattaatgaatgaatcacatcatcacatccatctgcatcaatgatctagaacggatcactattgacatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27522347 |
aaacttattacaagttaacgaatggccttaatattaatgactgaatcacatcatcacatccacctgcatcaatgatctagaacggatcactattgacatg |
27522248 |
T |
 |
| Q |
200 |
tcttctttccgattcccctactctttcagatatgtctatgatctgtgtt |
248 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
27522247 |
tcttctttccgattcccttactctttcagatatgtctatgatgtgtgtt |
27522199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University