View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19198_low_36 (Length: 251)
Name: NF19198_low_36
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19198_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 21 - 241
Target Start/End: Complemental strand, 29907692 - 29907472
Alignment:
| Q |
21 |
aacgaggtaatcatatcacatggatccttaatgtagacgggagtgcactaacaaatctaagtttggctggcttttgtggtctcattagaagacatgatgg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29907692 |
aacgaggtaatcatatcacatggatccttaatgtagacgggagtgcactaacaaatctaagtttggctggcttttgtggtctcattagaagacatgatgg |
29907593 |
T |
|
| Q |
121 |
gagcttcatatttaggttccatatgagtcttggtctgtttaatatccttcatgctgagattcaggcgttgtgtgtggatatcaaactatgttcggaagca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
29907592 |
gagcttcatatttaggttccatatgagtgttggtctgtttaatatccttcatgctgagattcaggcgttgtgtgtgggtatcaaactatattcggaagca |
29907493 |
T |
|
| Q |
221 |
tgattcatatctcttatctgt |
241 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29907492 |
tgattcatatctcttatctgt |
29907472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 43 - 181
Target Start/End: Complemental strand, 6448434 - 6448296
Alignment:
| Q |
43 |
gatccttaatgtagacgggagtgcactaacaaatcta-agtttggctggcttttgtggtctcattagaagacatgatgggagcttcatatttaggttcca |
141 |
Q |
| |
|
||||||||||||||| || ||||||| || |||||| |||||| | |||||| || ||||| ||||||| || ||||| |||||||||||| || |||| |
|
|
| T |
6448434 |
gatccttaatgtagatggaagtgcaccgacgaatctagagtttg-caggctttggttgtctctttagaaggcaagatggaagcttcatatttgggctcca |
6448336 |
T |
|
| Q |
142 |
tatgagtcttggtctgtttaatatccttcatgctgagatt |
181 |
Q |
| |
|
|||| ||||| || |||||||||||||||||||||| |
|
|
| T |
6448335 |
cgggagtgttggttggtctaatatccttcatgctgagatt |
6448296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 43 - 179
Target Start/End: Original strand, 45486574 - 45486710
Alignment:
| Q |
43 |
gatccttaatgtagacgggagtgcactaacaaatctaagtttggctggcttttgtggtctcattagaagacat-gatgggagcttcatatttaggttcca |
141 |
Q |
| |
|
|||| |||||||||| | | ||||||||||| ||| | | |||||| ||||| |||||||||||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
45486574 |
gatcgttaatgtagatgagggtgcactaacatatccaggcttggctagctttggtggtctcattagac-acattgatgggagcttcatattttggttcca |
45486672 |
T |
|
| Q |
142 |
tatgagtcttggtctgtttaatatccttcatgctgaga |
179 |
Q |
| |
|
| |||| ||||| || |||||||||||| ||||||| |
|
|
| T |
45486673 |
tgggagtgttggttggtctaatatccttcaagctgaga |
45486710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University