View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19198_low_41 (Length: 239)
Name: NF19198_low_41
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19198_low_41 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 51909132 - 51908910
Alignment:
| Q |
1 |
tagtttgcattaaaaaagaattgactaaaactgtgtttaaaaaggagcttatattcagaagctgtaatttcaaaagtgtcaagaaaaaatagaaaactga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51909132 |
tagtttgcattaaaaaagaattgactaaaactgtgtttaaaaaggagcttatattcagaagctgtaatttcaaaagtgtcaagaaaaaatagaaaactga |
51909033 |
T |
 |
| Q |
101 |
gactgaaacctgtaaatgcagttggaccagaatacatgatcagcagatatggaaggcaacacaacactttcactagtagaaaataatgtaacttgcatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51909032 |
gactgaaacctgtaaatgcagttggaccagaatacatgatcagcagatatggaaggcaacacaacactttcactagtagaaaataatgtaacttgcatta |
51908933 |
T |
 |
| Q |
201 |
aaaatattcc--gaggacaatgc |
221 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
51908932 |
aaaatattccaagaggacaatgc |
51908910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University