View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19198_low_42 (Length: 238)

Name: NF19198_low_42
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19198_low_42
NF19198_low_42
[»] chr3 (1 HSPs)
chr3 (5-181)||(6282094-6282271)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 5 - 181
Target Start/End: Original strand, 6282094 - 6282271
Alignment:
5 tttatgtcatactaatataaatgtggcatgatagagtcttgactaaccttcaatattatggcatcacctgttgggacacttttaaacatgtctccttcaa 104  Q
    ||||||||||| |||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6282094 tttatgtcatattaatataaatatggtatgataaagtcttgactaaccttcaatattatggcatcacctgttgggacacttttaaacatgtctccttcaa 6282193  T
105 tttgctcaattccttcataaaatcgataattcactca-ttagtgacaaacatgatatacatattaaagacattagggt 181  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
6282194 tttgctcaattccttcataaaatcgataattcactcatttagtgacaaacatgatatacatattaaagacattagggt 6282271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University