View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19198_low_45 (Length: 236)
Name: NF19198_low_45
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19198_low_45 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 15 - 236
Target Start/End: Complemental strand, 2064812 - 2064591
Alignment:
| Q |
15 |
agtcttgtcactagactcgctctaaagcgtttgaaggctttccctttagagtctcatgatatgcttgcatacattggaatatttatgtgcaagagaaata |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064812 |
agtcttgtcactagactcgctctaaagcgtttgaaggctttccctttagagtctcatgatatgcttgcatacattggaatatttatgtgcaagagaaata |
2064713 |
T |
|
| Q |
115 |
gtcttcaattttcaacccttcagaatcaaattgcccaaaactaacatccatagatgctgtttctttgttaagaaatttaattttctgtgcaggcaattcc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064712 |
gtcttcaattttcaacccttcagaatcaaattgcccaaaactaacatccatagatgctgtttctttgttaagaaatttaattttctgtgcaggcaattcc |
2064613 |
T |
|
| Q |
215 |
atcggttatggattgtagtgcc |
236 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2064612 |
atcggttatggattgtagtgcc |
2064591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 184 - 236
Target Start/End: Original strand, 2063978 - 2064030
Alignment:
| Q |
184 |
aagaaatttaattttctgtgcaggcaattccatcggttatggattgtagtgcc |
236 |
Q |
| |
|
|||||||| ||| || |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2063978 |
aagaaattcaatcttttgtgcaggcaattccatcagttatggattgtagtgcc |
2064030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University