View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19198_low_46 (Length: 235)
Name: NF19198_low_46
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19198_low_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 222
Target Start/End: Complemental strand, 34860356 - 34860151
Alignment:
| Q |
17 |
tactctatctgttgcataaatactctcggtgatgaatccaccaagaaaatttgcaagtaaaccttcagaaaggaccaattttgttttttaatcctagtac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34860356 |
tactctatctgttgcataaatactctcggtgatgaatccaccaagaaaatttgcaagtaaaccttcagaaaggaccaattttgttttttaatcctagtac |
34860257 |
T |
 |
| Q |
117 |
tacataactttgtttgcacttgttgtattgaatgtcattcattacaagaatcaaatatttgcaagtcattggatttagactatgcttaaaactgatatca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34860256 |
tacataactttgtttgcacttgttgtattgaatgtcattcattacaagaatcaaatatttgcaagtcattggatttagactatgcttaaaactgatatca |
34860157 |
T |
 |
| Q |
217 |
tatttc |
222 |
Q |
| |
|
|||||| |
|
|
| T |
34860156 |
tatttc |
34860151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University