View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19198_low_54 (Length: 217)
Name: NF19198_low_54
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19198_low_54 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 217
Target Start/End: Complemental strand, 33402898 - 33402690
Alignment:
| Q |
9 |
catcatcatctccatttcaacatgaaccatgaaactgatgcagttaaaatatacttcttccccttcgtaggtggaggacatcagattccaatggtagaca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33402898 |
catcatcatctccatttcaacatgaaccatgaaactgatgcagttaaaatatacttcttccccttcgtaggtggaggacatcagattccaatggtagaca |
33402799 |
T |
|
| Q |
109 |
cagcaagagtgtttgcaaaacatggagccacatcaaccatcataactacaccatctaacgctcttcaattccaaaactcaatcaccagagaccaaaaatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33402798 |
cagcaagagtgtttgcaaaacatggagccacatcaaccatcataactacaccatctaacgctcttcaattccaaaattcaatcaccagagaccaaaaatc |
33402699 |
T |
|
| Q |
209 |
caatcatcc |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
33402698 |
caatcatcc |
33402690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University