View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19198_low_57 (Length: 203)

Name: NF19198_low_57
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19198_low_57
NF19198_low_57
[»] chr3 (2 HSPs)
chr3 (13-187)||(54679375-54679549)
chr3 (19-63)||(54712194-54712238)


Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 13 - 187
Target Start/End: Complemental strand, 54679549 - 54679375
Alignment:
13 catagggaaagagaaaagaggttagggtccaatgatatgtatcgaatattataaannnnnnnaggctaagctaacttataggattgaattcagaataata 112  Q
    ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
54679549 catagagaaagagaaaaaaggttagggtccaatgatatgtatcgaatattataaatttttttaggctaagctaacttataggattgaattcagaataata 54679450  T
113 gtattactacaatgaagagggaagtaaaagaattgaatagtaatgcaaaagttataaagagtatgaatactaaat 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54679449 gtattactacaatgaagagggaagtaaaagaattgaatagtaatgcaaaagttataaagagtatgaatactaaat 54679375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 63
Target Start/End: Complemental strand, 54712238 - 54712194
Alignment:
19 gaaagagaaaagaggttagggtccaatgatatgtatcgaatatta 63  Q
    ||||||| |||||||| ||||||||||||||||||||||||||||    
54712238 gaaagaggaaagaggtcagggtccaatgatatgtatcgaatatta 54712194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University