View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19198_low_9 (Length: 479)
Name: NF19198_low_9
Description: NF19198
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19198_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 9e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 9e-68
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 37642854 - 37642663
Alignment:
| Q |
18 |
caaagttcatggataagccacattaggttaaatcagttttatgattttaatgctttctaatattctatcatagtgacacacaattattagctaa------ |
111 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37642854 |
caaagttcatggataagccgcattaggttaaatcagttttatgattttaatgctttctaatattctatcatagtgacacacaattattagctaaaccaac |
37642755 |
T |
 |
| Q |
112 |
----------accgcgctcatggtgtttctttcggtcatcggttgggcacataaagtatgacataagctttttggcacctttaaattaagaa |
193 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37642754 |
atagccttctaccgcgctcatggtgtttctttcgctcatcggttgggcacataaagtatgacataagctttttggcacctttaaattaagaa |
37642663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University