View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19199_low_3 (Length: 223)
Name: NF19199_low_3
Description: NF19199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19199_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 4 - 207
Target Start/End: Complemental strand, 6842449 - 6842249
Alignment:
| Q |
4 |
gatggacatcatcatgatgaaagctccatcaataaaggaaatcatcatgaatattccttataaattgtggttgagttatatattaactttgagggacctc |
103 |
Q |
| |
|
|||||| ||| | |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
6842449 |
gatggaaatcgttatgatgaaagctccatcaataaaggatatcatcatgaatattccttataaattgtggt-gagttatat--taactttgagggacctc |
6842353 |
T |
 |
| Q |
104 |
gtccacaccttaaacctagtagaaattgttccctcatcattaagggtgcaaatatatggttaactgaactatattgacaaactaaactgcactgaatcaa |
203 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6842352 |
gtccacaccttccacctagtagaaattgttccctcatcattaagtgtgcaaatatatggttaactgaactatattgacaaactaaactgcactgaatcaa |
6842253 |
T |
 |
| Q |
204 |
aaat |
207 |
Q |
| |
|
|||| |
|
|
| T |
6842252 |
aaat |
6842249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University