View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1919_high_5 (Length: 212)
Name: NF1919_high_5
Description: NF1919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1919_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 11477590 - 11477774
Alignment:
| Q |
18 |
ggattttggagaaaagcatgctttggagacgtgtccagaagaaccatatcatgctttgttctgaccaactgtgagtgtagagcttttcgcggattatagt |
117 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
11477590 |
ggattttggagaagagcatgctttggagacgtgtccagaagaaccatatcatgctttgttctgaccagctgtgagtgtagagcttttcgcggattatagt |
11477689 |
T |
 |
| Q |
118 |
gtcgcatactttttgtacttgatctcgcttgttgctttttcctacgtataccatctctagcggtgtacgtgtcgcctttgctact |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
11477690 |
gtcgcatactttttgtacttgatctcgcttgttgctttttcctacgtataccatctctagaggtgtacgtgtcgcctgtgctact |
11477774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University